Включить хром://флаги/#включить-NPAPI через манифест Puppet

Сочетание клавиш Ctrl+АЛТ+Ф2 по-прежнему получает вас в текстовой среде.

+596
Anil Bheemaiah 1 мар. 2016 г., 21:38:23
25 ответов

Это выглядит, чтобы достичь своей цели

#!/бин/Баш
для dir В {а..з}
делать
 Хорошо=$(найти ${реж}[0-9] -тип D -печати -чернослив 2>/Дев/нуль | хвост -1)
 если [[ "$хороший" ]]; затем
 Эхо $хороший
интернет
сделано

Пример использования:

$ команды mkdir А1 В1 С1 С2 С3 Д1
$ ./а.ш
А1
Б1
С3
Д1
$
+997
vamsi chaparala 03 февр. '09 в 4:24

Что многие из этих инструкций по запуску закваской для опары не сказать, что вы можете начать свой стартер, используя, скажем, чайную ложку муки и чайную ложку воды. Тогда в следующий раз, когда вы добавляете муки и воды, добавить 2 чайные ложки каждого. И увеличить его оттуда. Вам не нужно начинать с чашки муки и чашку воды. Боже мой, это так невероятно расточительно!

Кроме того, любой стартер можно снять, где в инструкции написано, что отказаться я хотел бы использовать, чтобы приготовить блины, кексы, пирожные, вафли и так далее. Есть много рецептов там для таких вещей.

+871
qianwei 21 мая 2019 г., 08:51:41
Другие ответы

Связанные вопросы


Похожие вопросы

Андроид эмулятор использует в QEMU в качестве гипервизора.

В то время как в QEMU появляется подражать малины Pi 2 вы должны прочитать в документации об руку поддержки , чтобы увидеть, если она соответствует вашим потребностям.

Обновление

Физические устройства имеют различные конфигурации драйвера, чем эмулятор.

И если вы хотите эмулятор для любой производительности вам придется использовать другую архитектуру процессора (х86 против АРМ). Обратитесь на добавление нового устройства в AOSP в документации (Примечание слои).

Я не знаю, если вы можете запустить бинарное изображение в AOSP на ИРЦ на QEMU, но это будет медленно (и еще нужно настроить быстрой загрузки и т. д.), этой теме: https://www.raspberrypi.org/magpi/android-raspberry-pi/ заставляет меня верить, что водители будут блокирующие точки.

Другое дело, что ведет меня, чтобы сказать, что вы хотите, это очень сложно , что это звучит, как вы хотите загрузить почти произвольных изображений. В данной статье на XDA по поводу EFIDroid показывает, что я думаю, что вы хотите, но ограничен набор поддерживаемых Qualcomm львиный зев устройства.

+830
ntlam 28 нояб. 2014 г., 12:24:38

Есть также камера хранения в Т2, что избавит вас от хлопот с возвратом в 10 мин ходьбы.

+812
Joshua Rey 19 янв. 2023 г., 09:57:40

Я начал узколистная эхинацея и Рудбекия hirta сеянцев недавно.

Я делаю полив опрыскиванием, если я могу увидеть или потрогать почти сухой почвы в клетки. В начале, я распыляется ванночки с водой, через каждые 2-3 дня. Однако, потребность в воде увеличивается, так как рассада развивается! Сегодня и вчера мне нужно было опрыскивать их дважды в день.

Это нормально? У вас есть подобный опыт?

Фотографии моей подносы сеянца:

Эхинацея:

enter image description here

Рудбекия:

enter image description here

+747
faragelfadaly 20 июн. 2022 г., 08:18:13

У меня два fasta файлы, как показано ниже,

Файл:1

>Contig_1:90600-91187 
AAGGCCATCAAGGACGTGGATGAGGTCGTCAAGGGCAAGGAACAGGAATTGATGACGGTC

>Contig_98:35323-35886
GACGAAGCGCTCGCCAAGGCCGAAGAAGAAGGCCTGGATCTGGTCGAAATCCAGCCGCAG 

>Contig_24:26615-28387
GCTGCGGCGCTGATCCTGGCGGCCCGCGCCGAGGAGATCGCCCGTTTGGAGCGCGGCGAA

Файл2

>Contig_1:90600-91187
GACCGTCATCAATTCCTGTTCCTTGCCCTTGACGACCTCATCCACGTCCTTGATGGCCTT 

>Contig_24:26615-28387
TTCGCCGCGCTCCAAACGGGCGATCTCCTCGGCGCGGGCCGCCAGGATCAGCGCCG

Оба файла имеют одинаковые заголовки Фаста, но в различной их последовательности. Мне нужно заменить файл:2 последовательности в файле:1, как показано ниже,

Ожидаемые результаты:

>Contig_1:90600-91187
GACCGTCATCAATTCCTGTTCCTTGCCCTTGACGACCTCATCCACGTCCTTGATGGCCTT 

>Contig_98:35323-35886
GACGAAGCGCTCGCCAAGGCCGAAGAAGAAGGCCTGGATCTGGTCGAAATCCAGCCG 

>Contig_24:26615-28387
TTCGCCGCGCTCCAAACGGGCGATCTCCTCGGCGCGGGCCGCCAGGATCAGCGCCG

Я попытался с кошкой команду, но это обьединении всех последовательностей. Но, мне нужно заменить Файл1 Файл2 последовательностей с последовательностями.

+738
Thanasis Malasidis 30 нояб. 2010 г., 18:17:24

Да, он сделал. Это показано в главе 603 (на первой странице), что Zetsu дали возможность присмотреть

Попыталась передать, пока он выздоравливает.

+737
Loilo 20 февр. 2016 г., 19:51:46

Я пытаюсь создать скрипт для копирования символьных ссылок папку data и моя идея-создать одну папку и создать несколько символических ссылок в этой папке, где при помощи rsync затем скопировать данные в этих каталогах:

/резервных копий/местного/
/резервное копирование/местные/и т. д. # симлинк в /etc/
/резервное копирование/местного/ВАР # симлинк в /var/
/резервных копий/местные/Home # симлинк на /Home/

Это становится проблемой и озабоченность тем, что при копировании файлов - теперь я не придется беспокоиться о других симлинки далее вниз по линии. Что я хочу увидеть, как произойдет то, что он обрабатывает только корневые каталоги символические ссылки, чтобы скопировать следующие папки, но и любую симлинки найти в файле/etc/ файле/var/ или /домашний/ не копируются.

Для тестирования я поставил еще одну символьную ссылку в/etc/ внутри /дома/ в /дома/и т. д. И все варианты я попробовал его копии /дома/и т. д/ каждый раз и его полное содержимое файла.

Я нашел и попробовал следующие варианты, думая, что эти варианты могли бы быть то, что я искал:

в rsync-AVZ по -Л [параметры] # я знал, что это копия все так и получилось.
в rsync-AVZ-ом -я ... копировать-Опасные связи [параметры] # копирует все ссылки рекурсивно до сих пор.
в rsync-AVZ-ом --копия-Опасные связи [параметры] # еще копирует все ссылки файла/содержание рекурсивно

Я попробовал --копия-небезопасно-ссылки нужным так как это написано в MAN-странице, что корень сим-ссылки считаются небезопасными, поэтому я подумал, что возможно будет только скопировать корневой сим-ссылки.

+711
Cory Gagliardi 9 апр. 2017 г., 14:26:30

Выключите примечания на компьютере Mac (в настройках iCloud) Запустите приложение (вы должны найти его пустым - никаких замечаний) Выйти из приложения поворот ноты обратно на в настройках затем запустите приложение "Заметки"

Работал для меня..

+626
user61120 2 нояб. 2022 г., 02:28:08

Я просто попросил Яблоко-недалекие приятель делает основной так здорово, и он в основном сказал, что Keynote имеет отличный экран во время презентации, показывая свои заметки и прочее. Он не мог назвать одну уникальную особенность, которая сделала основным круто кроме того. И как это происходит, OpenOffice.org имеет ту же самую вещь. Уверен, что интерфейс будет немного отличаться, но - как я понимаю - нет ничего, что вы можете сделать с основным, что вы не можете сделать в Impress.

+602
James Maxwell 8 апр. 2021 г., 16:33:06

Я не вижу ничего плохого в ваш хрон, как вы его описали. Я хотел бы предложить, глядя на сообщения этой системы, чтобы увидеть, когда cron запускает эту работу. Должна быть запись в журнале каждый раз, когда он работает.

+581
tkelch 1 авг. 2010 г., 22:42:59

Я свой старый телефон HTC труба A333. Недавно я включил его обратно в ИК-ROM и я увидел, что качество снимков, сделанных с умолчанию HTC приложение камеры, кажется, лучше. Не слегка. Довольно действительно немалую сумму.

Я знаю, что четкость картинки связано с самой камерой. Я снова переключился обратно на CM9 и когда я включил камеру, я мог видеть ясность была плохая (без съемки, просто через интерфейс приложения. Я хоть и фотографирую, и качество было плохое. Настройки были все на месте).

Даже когда я использовал другое приложение камеры, качество было довольно плохо. К сожалению, я не смог прошить HTC камера на СМ мод, чтобы увидеть, если это то, что делает разницу.

Программное обеспечение влияет на качество изображения? Если да, то как?

+516
user3669538 27 июл. 2018 г., 13:44:26

Я интересно, если есть способ, чтобы "раскатать" DMG-файла и выявить, какие каталоги будут установлены файлы?

+509
Hungle7289 20 февр. 2016 г., 21:42:32

Не уверен, что ваш случай подходит, но его можно продлить паспорт США в течение 24 часов, которые вы должны попробовать, чтобы сделать для вашей сестры. https://travel.state.gov/content/travel/en/passports/apply-renew-passport/hurry.html

+500
porkur666 30 авг. 2016 г., 01:17:11

Вино меню появляются и исчезают с глиссады 2 эффекта. Это выглядит хорошо для диалогов, но не так хорошо для меню. Я хотел бы сделать настраиваемое правило для применения исчезают в/, а не исчезать, но я не знаю тип окна для винного меню. Я попытался с помощью xwininfo , но нет возможности выбрать вино меню с ним.

+499
yojo 17 мая 2019 г., 07:58:03

Я пробовал какой-то пример, но это для меня не понятно.

ПЕРВЫЙ ПРИМЕР

#!/бин/Баш
я=0
в то время как [ $я -ЛТ 10 ]
делать
 Эхо "$я"
 я=`Эхо "$я + 1" | до н. э.`
сделано

вывод ===> 0,1,2,3,4,5,6,7,8,9

теперь, когда я выполнил, а "в то время как [ истинного ]" это дает выход как бесконечный цикл //согласен//
но когда я запустил время "время [ ложные ]" это дает выход как бесконечный цикл. /Я не согласен/

Не могли бы вы объяснить второй цикл while? и как он на самом деле работает?

в то время как [ ложь ] #дать бесконечный цикл
в то время как [ истинного ] #дать бесконечный цикл
в то время как [ 0 ] #дать бесконечный цикл
а [ 1 ] #дать бесконечный цикл
а [ `Общ` ]
а [ `Эхо 1` ] #дать бесконечный цикл
при((0)) #петли не выполнять
а((1)) #дают бесконечный цикл
+383
rld 15 окт. 2022 г., 04:39:29

Разница между фигурными скобками и скобки, что брекеты (и !) являются зарезервированными словами, просто как для, Если, то и т. д. в то время как скобки являются операторами управления. Слова должны быть разделены пробелом.

Это значит, что просто так вы не можете иметь

foriin*; делать

вы не можете иметь

{somecommand;} >файл

или

если !somecommand; затем

Пространство показано в грамматике POSIX не пробелы, которые нужно есть во входных данных оболочки, а лишь способ отображения самой грамматики. Это то, что брекеты являются зарезервированными словами , что означает, что они должны быть окружены пробелами, а в скобках в подоболочку не.

+358
Arun Al 8 окт. 2020 г., 20:22:54

ГНУ грэп (который я предполагаю, что вы используете), не знаю как вкладка по умолчанию. В регулярное выражение POSIX, будет соответствовать литерал т, а \\т будет соответствовать .

В соответствие символу табуляции с регулярное выражение POSIX, вставьте в ваше выражение:

грэп -Р $'".*\Т.*"' .

При этом используется $'...' в Баш , чтобы расширить escape-последовательности в строке в соответствующие смыслу в языке Си.

Если вы включите Perl-подобные регулярные выражения (PCRE вместе) с -п в GNU grep в, он распознает как символ табуляции в выражении:

грэп -р -р '".*\Т.*"' .

Тоже обратите внимание, что ваше выражение будет соответствовать

"привет" клавиша <Tab> "мир"
+316
antoniu200 20 июл. 2012 г., 19:06:25

Используйте команду кронтаб -е и добавить в кронтаб строку:

0 13 * * 2 СР -пра /usr/местные/src/и djcode/c2duo_mms /дом/ш
+265
Richard Nygaard 22 мая 2011 г., 18:59:00

Я получил штраф в Норвегии за превышение скорости на 9 км (60 км / ч). Штраф составляет 225 евро. Я хотел заплатить на месте, но они не принимали.

Они сказали мне оплатить его в течение 14 дней. Я вернусь в страну через 30 дней. Что делать? Я не получите картину проносящихся МВт: полицейские говорят, что они не имеют рисунка.

Это справедливо не показать мне фото, где я превысил скорость? Это хорошо действует без скорости фото?

Что произойдет, если я плачу поздно? Что если я не заплачу?

Спасибо.

+259
merstar 7 мар. 2019 г., 18:46:18

Я не уверен, что вы спрашиваете точно, но телепатия-это платформа обмена мгновенными сообщениями, который использует эмпатию.

Если 'он' - это один через Bonjour, а затем кто-нибудь в локальной сети с клиент настроен на работу с этим, сможете пообщаться с сочувствием посредством этого метода, в том числе iChat на ОС Х, где этот метод зародился.

+256
shankshera 30 июн. 2013 г., 07:02:49

Как вы будете жить с вашим родственником и он будет нести часть расходов, да, вам придется ответить " да " на вопрос: "кто будет оплачивать расходы на ваш приезд". Вы сможете объяснить, кто и сколько, как вы думаете они будут тратить на тебя в форме, либо в объяснении по этому вопросу или в другие части формы. Пребывание с родственником и забрав часть нашей еды там должны делать.
Ваш двоюродный брат не является спонсором вашей поездки, что будет, если он оплачивает часть расходов на проезд и из вашего текста я не получаю впечатление, что он будет делать так.

Я думаю, что правильная английская версия для отношений ваших детей с вашим хозяином будет 'двоюродный брат' (троюродный брат может быть более точным, но как кузен большой улов слово, я думаю, что сами должны делать, даже если с другого поколения "дядя" представляется более естественным способом решения.) Вы также можете сказать, кузен родителем, если это соответствует.

+227
Teker 7 июл. 2016 г., 21:43:18

Я лично использовать Ctrl-J для ГНУ экран по 2 причинам:

  • он обычно привязан к ключ вернуться, поэтому не очень привык,
  • палец обычно находится там, если вы не профессиональная машинистка.

    побег ^й

+147
Bryan Nevin 25 сент. 2012 г., 18:39:31

Один снимок процессора нагрузки не очень полезны, кроме того, нам нужно понять конфигурацию машины (это микро-раздела, что право емкость, сколько виртуальных процессоров и т. д.)

В конечном счете, нужно исследовать проблему, используя что-то вроде nmon (topas_nmon если ваша версия AIX он встроенный).

Если машина действительно 6.1.0.0, то вы должны также патч на многое, многое другое последние версии AIX, прежде чем волноваться слишком много об одной проблемы с производительностью.

Поэтому в резюме - нет, где рядом достаточно информации, чтобы обоснованно ответить на ваш запрос.

+143
user25854 10 мая 2023 г., 09:32:49

Только покрытие 1) Ваш вопрос.

Естественно Апис всегда можно изменить по воле их создателей, и так перерыв зависит от программного обеспечения, на любом языке. Что сказал, великой идее Unix инструментов ввода/вывода "Апис" является то, что в ней практически нет (возможно 0x0a как конец строки). Хороший сценарий фильтров данных с использованием средств системы Unix, вместо того, чтобы создавать его. Это означает, что ваш скрипт может сломаться, потому что вход или выход спецификаций изменилось, но не потому, что ввода-вывода формат (опять же, там не один) отдельных инструментов, используемых в скрипте изменил (потому что то, что реально не существуют, не могут реально изменить).

Пройдя через список основных инструментов, есть несколько, которые я бы также атрибут производителя, а не только фильтра:

  • туалет - принт количество байтов, слов, строк -- очень простой формат, так совсем вряд ли изменится, и к тому же не очень вероятно, будет использоваться в скрипте.
  • дифф - здесь развивались различные выходные форматы, но я не слышал каких-либо проблем. Также обычно не используется без присмотра.
  • дата - вот теперь мы действительно должны заботиться о том, что мы производим, особенно в отношении языка системы. Но в противном случае выходной формат РЧЦ объед дал вам точно не указать его самостоятельно.
  • коэф - давай не будем говорить об этом, я знаю, что выходной формат не очень сильно отличаются в разных системах.
  • ЛС, кто, ж, последнее - я не могу помочь, если вы хотите, чтобы разобрать LS, это просто не должно быть. Также, Кто ж, наконец, являются более интерактивными, листеры; если использовать их в сценарии, вы должны заботиться, что вы делаете.
  • время было указано в другом посте. Но да, это так же, как с общ. Более для интерактивной/местного применения. А встроенная команда bash сильно отличается от версии GNU, а GNU версия имеет неисправленных ошибок в течение многих лет. Просто не полагайтесь на это.

Вот несколько инструментов, которые ожидают формата конкретного ввод более конкретные, чем поток байтов:

  • до н. э., постоянного тока -- калькуляторы. Уже на более программистские вещи (правда, я не использую их в сценариях), и, вероятно, очень стабильный форматы ввода/вывода.

Есть еще одна область, с гораздо более высокий риск поломки, а именно интерфейс командной строки. Большинство инструментов имеют разные характеристики как по системам и по временной шкале. Примеры

  • Все инструменты, с помощью regex -- регулярные выражения могут изменять смысл в зависимости от языка системы (например категории lc_collate) и есть много тонкостей и особенностей по реализации регулярных выражений.
  • Просто не использовать необычные выключатели. Вы можете легко использовать 1П найти человека например, чтобы читать в POSIX найти страницу вместо системы man-страницы. На моей системе, мне нужны страницы в POSIX установлены.

И даже при использовании таких выключателей, как правило, там ошибок не будет тонко ввел и отравить ваши данные. Большинство программ просто отказываются работать с неизвестным переключатель.

В заключение я хотел бы сказать, что раковина на самом деле имеет потенциал быть одним из самых портативных языков (портативный, когда вы сценарий переносимо). Сравнивайте ваши любимые языки сценариев, где тонкие ошибки, или ваш любимый скомпилированную программу, которая будет уступить компиляции.

Кроме того, в тех редких местах, где поломка может произойти из-за несовместимости, то вряд ли из-за времени наводится, но из-за различия между различными системами (то есть, если он работает для вас, это было сделано на 20 лет раньше и в 20 лет тоже). Что является следствием простоты инструменты'.

+30
MaLm1 13 авг. 2014 г., 11:32:25

Показать вопросы с тегом